Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12229A12
Clone ID IST12229A12
Vector VICTR76
Project tigm

Sequence tag IST12229A12BBF2
Sequence
CAGGTAGAACAAGTCAGAGGCAGCGCTGAGGGTCCTTCCTTGGTTAATAGGATTCTTGTTTTTATCCAGCAACAGGAAGT
GGTTGTTTGGTGTGTTGTTAGTGTTTGCTCGGGTTTTCATTCNNTTCCTGTTCANCATGCTGAAATTCAATGGATTGGCN
TTGTGTTGTGATGTTCAATAAATGTGTCTANAGTGCGCNGANATCTG
Sequence Type genomic DNA
Unitrap ID UNI34676

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 115605342..115605547 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022112 (Gpc5) NM_175500 glypican 5 Gene [Source:MGI Symbol;Acc:MGI:1194894]

 
Come back to gene ENSMUSG00000022112


For any suggestions or comments, please send an email to unitrap@crg.es