Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12271C9
Clone ID IST12271C9
Vector VICTR76
Project tigm

Sequence tag IST12271C9HMF1
Sequence
GAAGAAGGAACTTCAGGAGCACTGCCTCACAGACTTTGGGCAGAATATCCACCCTTCAGAACAACATGGTGGACCGTGTA
AGGTCATCACCTACCCAAGCTTACGTAGGACTAGAAAGACCAACATTCTATGACTCCCAGGTTCCACATCAGCTAGGACA
GTTGATCAACCTTGATTGGAGGCTGTAGTGGAGGCTGCTCAATACAGTCCTCCCTCGGGGCCCTGGAGAGGCTAGGGACC
TCCGTGGCTAAATATGTCCTGTGCAAGAGGGGTGACCTACAAGCGACTCCACCTGATCCCACTCTGCCCTGACCAAGGCT
TGCTGTGTGATCCCCTGTATGGGTGTGTCCTCAAGTAGGTGTCTAGATGCCACCTGGGCAGGATACATGGGGTTCCTGTC
CTGACATTGTTTTGAGCTCTGGAATGTTTTTTCGGCCNACTTTATCAGAAAGCATATTTGTGGGTGAGTGCTGCTAACAG
GGCCNGTCTGGTGANGGCTGGGGGGCTGGGGG
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148284456..148284965 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST12271C9BBF1
Sequence
GAAGAAGGAACTTCAGGAGCACTGCCTCACAGACTTTGGGCAGAATATCCACCCTTCAGAACAACATGGTGGACCGTGTA
AGGTCATCACCTACCCAAGCTTACGTAGGACTAGAAAGACCAACATTCTATGACTCCCAGGTTCCACATCAGCTAGGACA
GTTGATCAACCTTGATTGGAGGCTGTAGTGGAGGCTGCTCAATACAGTCCTCCCTCGGGGCCCTGGAGAGGCTAGGGACC
TCCGTGGCTAAATATGTCCTGTGCAAGANGGGTGACCTACAAGCGACTCCACCTGATCCCACTCTGCCCTGACCAAGGCT
TGCTGTGTGATCCCCTGTATGGGTGTGTCCTCAAGTNNGTGTCTAGATGCCACCTGGGCNNNATACATGGGGTTCCTGTC
CTGACATTGNTTTGANCTCTGGAATGTTTTTCNNCCNACTTTATNANAAAGCN
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148284456..148284908 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es