Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14857G12
Clone ID IST14857G12
Vector VICTR76
Project tigm

Sequence tag IST14857G12HMR1
Sequence
NNCAAGGGTGGGGCACNCCCCAAACATCCCCTTCTCTAGGAAGTGGAGCCAGCCATGTGATGTGCATTTCTCACCGTTAT
TGTTCCCCATGACATAAAGGAACTTGTCAAAATCCAAGAAGCCCAAGTCGTTCGTGTGTANCCNGCCGTGGGTGTCCACC
TTCCTCTCTGTGCTCTGCTTGTCTCTGAGGTACCCCATGAATATGTGGCGGCCCCANATACACAANTTCCCNANCCCATC
CTTGTTTTCTTTTTCNACCTTTGTGTGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57024196..57024464 247
NO GENE  


Sequence tag IST14857G12BBF1
Sequence
GATGTGGCTTTTCAGAGACAAATGCTTCTCTTTGTTACTACAGATTTGATCAAGCTGAGCTCGGGGGAAATGGTCAACCC
GTATCCCATCGAGGAGCGGGTAAGGACGCGAATCCCCATCGTCCGCTATGCCATGCTGGTGGGCCAGGACGCCCCGTACC
TGTGCGCCCTCCTCACATTGAAGGTACCCNCGGAGCAAGACTCTGACCAGATGAAGGGTGGGCTGGATGANNGTCTTCGT
TTNNANTGGNCTTTNGTNNNGN
Sequence Type genomic DNA
Unitrap ID UNI17702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57024464..57024720 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST14857G12HMF1
Sequence
GATGTGGCTTTTCAGAGNCAAATGCTTCTCTTTGTTACTACAGATTTGATCAAGCTGAGCTCGGGGGAAATGGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI36418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57024464..57024541 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es