Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14958E2
Clone ID IST14958E2
Vector VICTR76
Project tigm

Sequence tag IST14958E2HMF1
Sequence
CTGCTGCCTCTGGAGTGCTGGAATTAAGGCTCCCTGCACCACCACACCTGGTGCCAGGCTCCTCGTTACTCTTAAAGGGA
AGACAAGTCACTTTTTCTTCAAATGGCTCATTATCTACCATGAATACAAACATTTTTACAGTCATGGTGTGATTTTTTAA
AAGATTTATTTATTTATTTCTATTTATATGAGTACACTGCAGCTGTCTTCAGACACACCCTAGAAGATTGCATCGGATTC
CATTACAGATGGTTGTGAGCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37941496..37941757 262
NO GENE  


Sequence tag IST14958E2HMR1
Sequence
GCAGGAGCAGGTGAATCTCCGAGTTTGAGGCCAGCATGGTCTACAGAGCTAGTTCCAGCCAGGACAGTCAGGGCTACACA
GAGAAAACCTGACTCAAAACCAAACCAAACCAACAAAAAAGTGAGAAAGGAAATAGCCCTAAGGAGTTAATTTTTTTTCT
ATGAGATTTAAATATAACCTTTAAAGATTTATTTTATGTATGTGAGTGTTTTGCTCACTTANATCTGCACCATATGCATG
CCTCGTGCACAAAGTGGTCATAAGAAGCCATTGGATTCGCTGTAATTAGACTTCTGGACTGTGGGTCCTGGGAATCGAAC
CTAGGTCCTCTGCAANAACAAGTCTTAACCGCCGAACCNTCTCTCTAATCCCATTANATTCTAAAATTATTTTCCTGCAA
TATGATTTCACCNNNGAAAATGAATTAAAAGAATAACGCCNNTGGGAAATAAAGTANTTTTCCTGCAAACNTGCNTGCAG
CATGCAGGTGGGTCTGTGCTGTCCTGAANCCNNTGCATGCCNNGCAAGCNCTCTAACN
Sequence Type genomic DNA
Unitrap ID UNI32677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37941754..37942290 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039087 (Rreb1) NM_001013392 ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]


Sequence tag IST14958E2BBF1
Sequence
CTGCTGCCTCTGGAGTGCTGGAATTAAGGCTCCCTGCACCACCACACCTGGTGCCAGGCTCCTCGTTACTCTTAAAGGGA
AGACAAGTCACTTTTTCTTCAAATGGCTCATTATCTACCATGAATACAAACATTTTTACAGTCATGGTGTGATTTTTTAA
AAGATTTATTTATTTATTTCTATTTATATGAGTACACTGCAGCTGTCTTCAGACACACCCTANAAGATTGCATCGGATTC
CATTACAGATGGTTGTGAGCCACCATGTGGGTTGCNANGANCTGAACTCANGACCTCTGGCNNANCANNCNNTCANTGCT
CTTCNCCACTGANNNNNNTCTNCNNCNNNATGGTGTGANTNNGANNNANNANCNGGNANCNGATTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039087


For any suggestions or comments, please send an email to unitrap@crg.es