Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11442E1
Clone ID IST11442E1
Vector VICTR76
Project tigm

Sequence tag IST11442E1BBF1
Sequence
NTGCCTGCCCCTCCCTGCAGCACAGTCAAGCAGGCCTTCTTGCCTCAGTTACGCATCTGANATAACCCCCATAAGCACAG
CCAGACACCAACCTAATTTAAACACATTTTACCCANCACGTGGGAGGCAGGAGCAGGCAGGTCGCTGAATCCAGGGACAG
TCTGGTCTAANTNNTGANATCCTGTATTTAAAAAAAAAANCN
Sequence Type genomic DNA
Unitrap ID UNI34686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 144101802..144101999 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040151 (Hs2st1) NM_011828 heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]

 
Come back to gene ENSMUSG00000040151


For any suggestions or comments, please send an email to unitrap@crg.es