Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14442C8
Clone ID IST14442C8
Vector VICTR74
Project tigm

Sequence tag IST14442C8HMF2
Sequence
GTGTACACAGTAAGCTGTTCCTCTCGTTCTCATCCTGCCAAGTATGTTTCCACACACAAGCCCCTGCCACAAAGATTTTG
TCCAGTGCAGTCTTATAATAAAGTTACTCANAGGCCACAGCTGGGACCAAAAGGAGAGAGTAGGTCCACAAAGGACCTCA
CAGATGTCCCCATCTGTCTGGCTGATGCTGACAATCCNACCTCTGGGAANANATATTACACANGCATCCNTTGCNANNAT
GCTTGCTNNNCCNNTTNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14442C8BBF1
Sequence
GTGTACACAGTAAGCTGTTCCTCTCGTTCTCATCCTGCCAAGTATGTTTCCACACACAAGCCCCTGCCACAAAGATTTTG
TCCAGTGCAGTCTTATAATAAAGTTACTCAGAGGCCACAGCTGGGACCAAAAGGAGAGAGTAGGTCCACAAAGGACCTCA
CAGATGTCCCCATCTGTCTGGCTGATGCTGACAATCCAGCCTCTGGGAAGAGATATTACACAAGCATCCTTTGCTAAGAT
GCTTGCTCCTCCTCTTTGTGGGAGATGACATTGCACTTACCATGTCTGAAGTTCTAAGTTTGCCTGAGCTAACCTCACAG
CANCNNGCANANATAATAAGAACCGATTCCNCNGANNCNCTGAGATCANCTGAGTTACACNNANGAACATGCANGCTTAN
TAACTGGAANANTCNCCTCCTCTTCTGACTGGCNNCTCCNTGTGGAGGCTCTAANTNNCTANTGANTCNTGAGTGANGTG
NACACCANGCNNANGGTNAGAGTGNACTGTNNANNTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14442C8HMR1
Sequence
TACACTGTCAGGTAAAAGAGTGCTGACAAGAGCTAGGTCACAGACCAAAGGAAAAGGGAGTGTGCTGCAGGGGTCATGGT
TATGGAGAAGGTCCTGGTTAGGGCAGTGAGAATGATTTTGTAACTTCACAGACTGTATCCATGTATGGATCTAATTTAGT
AAACCTANATTGAAGGGTGTTTTATTTAATCNGGTTANCTTGANCCNNTGNGTNNTGAATTCCCATTTN
Sequence Type genomic DNA
Unitrap ID UNI33179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177761701..177761928 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074519 (Etohi1) ethanol induced 1 Gene [Source:MGI (curated);Acc:Etohi1-001]

 
Come back to gene ENSMUSG00000074519


For any suggestions or comments, please send an email to unitrap@crg.es