Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14245A6
Clone ID IST14245A6
Vector VICTR74
Project tigm

Sequence tag IST14245A6HMF1
Sequence
CTAAGGCCNGCCTAAGCTACGAGAGACCCCGTCTCAAAATAAAATAAAGTTGGCTGGCGCAAGGCCCCCTGTTTGTAGCA
GATGTGCAGCTTGGTCTTCAAGTGGATCAGCCTGGGGCTGTCTCTGACTCTCTTACCTGCCATTGGATGTTGGCTTCCCT
TCCCCTACCTGGACTTCCTGGTTGGGCCTCAGCAGGAGATGATGTAACTGGTCCTGCTGGGACTTTGGCATCCCGTGGGG
GAGTGNNNNNNAAGGGGGCTTCCCCTTCTCTGANAAGAGGGGGGAGGGGATAATGGGAGAGACTGNNANGNGAGGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123036853..123037169 293
NO GENE  


Sequence tag IST14245A6HMR1
Sequence
NAGAANTNNNGTGTGGCTGAGGATGACCTTGAACCCCTGATCCTCCTGACTTCCCCTCCCAAGTGCAGGGATTACAGGCT
GTGCTGCTGTGCACTGTTGATTCCATGCTGGGATTGATCCTAGCCTAGGGCTTCATACAGGCTANGTCC
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123037178..123037315 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]


Sequence tag IST14245A6BBF1
Sequence
CTAAGGCCAGCCTAAGCTACGAGAGACCCCGTCTCAAAATAAAATAAAGTTGGCTGGCGCAAGGCCCCCTGTTTGTAGCA
GATGTGCAGCTTGGTCTTCAAGTGGATCAGCCTGGGGCTGTCTCTGACTCTCTTACCTGCCATTGGATGTTGGCTTCCCT
TCCCCTACCTGGACTTCCTGGTTGGGCCTCAGCAGGAGATGATGTAACTGGTCCTGCTGGGACTTTGGCATCCCGTGGGG
GANTGATACCNANGGGGGCTTCCCCTTCTCTGANAAGAGGGGGGAGGGGATAATGGGAGAGACTGGGAGGAGAGGTGGGG
GCTCNATCGGGNTNTANAGGNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123036830..123037169 324
NO GENE  

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es