Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11406A4
Clone ID IST11406A4
Vector VICTR76
Project tigm

Sequence tag IST11406A4HMF1
Sequence
ATAGGAGGTTTGTAGTACTGGAAATCAAACTCAAACCCTCTAGGTAACTACTCTTACCAGCTAAGCTACATCCTTAACCA
GATGCAATTTTTTGTAAGCCCTTGGTCGATTCAATTCATCAATACAAAAAAACTCAAATATAGAAAGCCAACTGTACTTC
ACCCAGTTTCTCAAACAAGTTAAGTAATCTGTGACTTCACATATTCCTTCCCTTGAAGCANCCTCTGCACACTTCCTANC
TGTGAGTTCCNAACTGTCTGTGCAATACANAACTCAACGAGCCATCCTGTGCTCTGTCTCCTTGTCTACNCCCATACTAT
ANACNGNANGGGGTTCCTCCCAATGCTGGCACAGCCCACTANCNNTTGAGTNANNNNNCACTGAAAAGAAAGACAGATTG
GCACGTAGTCTTCCTCACATCTGCTATAATAATATTATATACAATAATCATTACNATAATATATGAGTNATAATAAAGAA
GTATTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11406A4HMR1
Sequence
NATGAAGGAGATACAGGCATATGGATNNNAAATTCAAGGTCACCCTCAACTACATAACAAGTTCAAGGCCAGTCATGGCT
ATATCANAAGTCTCAAGAGGAAAACTTGGCATGTAAAACATAAAAAATAATTCCCTGTGCTGGATGCCTTTATGTCC
Sequence Type genomic DNA
Unitrap ID UNI8501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73907331..73907485 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028397 (Jmjd2c) NM_144787 jumonji domain containing 2C Gene [Source:MGI (curated);Acc:Jmjd2c-006]

 
Come back to gene ENSMUSG00000028397


For any suggestions or comments, please send an email to unitrap@crg.es