Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14770C8
Clone ID IST14770C8
Vector VICTR76
Project tigm

Sequence tag IST14770C8HMF1
Sequence
AATGAAGATAGAAAACAACTTAGAAGTGATCACTGATAAGGGTTCTGAAGGANAGGCCATAAGCATGATAACTACAAAGA
AGCATCAAGAAACAACTGTGCTGACCACAGTTCTGCATTTTGATTTGGATGGTCACAAAAGCTACTAAAGCAAATTAAAA
CTGTTTAGAAACATGCCAAATGCCTTTGCAAGTACATGTATGTACACACAAAAGATACCTGAATAATCTACTCTGACAAA
AGCTGACTAGGCTGGAGCTGTGGTTCAGTAGCAGTGAGAGATGAGTGCTCACGAGGCCCCTATGTTTAAGCCTCAACACC
ACAAAGAAAGTGGTAAAGAATATATGTGCATCAATCTCAGCTTTCTGGTTCTTATAATACATTCTTAGTTCATAATGTGA
ATGGNNTANGAAGGGATGCCTGNATAGAANCTCCCTATATCTTNACATTTTAATTAATGNNGTTTGTGTATGAANGNTGT
CNGCNTGTCTGTGTACCNNNTGCATNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105061743..105062247 473
 
EST/CDNA Est Name
  BF469294.1


Sequence tag IST14770C8HMR1
Sequence
ATTGATTTCTTTTGAGTTAATGTTTAAAATTAAGACTCTGGCTTGTGGATGTCTTTAGTATTTCAGGGCCATTTACTGAA
AGACTTTAATTTTCTTTTTTTTTTNCTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI25340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105062245..105062360 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]


Sequence tag IST14770C8BBF1
Sequence
ATNNAGATANAAAACAACTTAGAAGTGATCACTGATAAGGGTTCTGAAGGAGAGGCCATAAGCATGATAACTACAAAGAA
GCATCAAGAAACAACTGTGCTGACCACAGTTCTGCATTTTGATTTGGATGGTCACAAAAGCTACTAAAGCAAATTAAAAC
TGTTTAGAAACATGCCAAATGCCTTTGCAAGTACATGTATGTACACACAAAAGATACCTGAATAATCTACTCTGACAAAA
GCTGACTAGGCTGGAGCTGTGGTTCAGTAGCAGTGAGAGATGAGTGCTCACGAGGCCCCTATGTTTAAGCCTCAACACCA
CAAAGAAAGTGGTAAAGAATATATGTGCATCAATCTCAGCTTTCTGGTTCTTATAATACATTCTTAGTTCATAATGTGAA
TGGGGTAGGAAGGGATGCCTGAATAGAAGCTCCCTATATCTTTACATTTTAATTAATGTAGTTTGTGTNTGAATGTTGTC
TGCGTGTCTGNGTACCACGTGCATGCNTCCAANGNNAGANAGCTTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105061715..105062242 508
 
EST/CDNA Est Name
  BF469294.1

 
Come back to gene BF469294.1


For any suggestions or comments, please send an email to unitrap@crg.es