Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10826C1
Clone ID IST10826C1
Vector VICTR76
Project tigm

Sequence tag IST10826C1BBF1
Sequence
AAACAATTTCTCAAGAACAGAATTCTAAGAATTTCAAGGAGGGCTACCATCCAAGAAGTCGTTCAGCACAATCCACACAT
GAATTCAGATAGCAAAAACTGGGGTAACCTGGGATCAAACAGTGAAGTCCTGAGGAATGTGTTGTCGGTATGGGCGTGGC
CAGGTCTAGGATCT

Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94007183..94007355 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]


Sequence tag IST10826C1HMF1
Sequence
AAACAATTTCTNANNNNNNNAATTCTAAGAATTTCAAGGAGGGCTACCATCCAAGAAGTCGTTCAGCACAATCCACACAT
GAATTCAGATAGCAAAAACTGGGGTAACCTGGGATCAAACAGTGAAGTCCTGAGGAATGTGTTGTCGGTATGGGCGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es