Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13052D7
Clone ID IST13052D7
Vector VICTR76
Project tigm

Sequence tag IST13052D7HMF1
Sequence
CTGACTGTCCCATCTGAGCTCACTGCGGTTCCTTTATGGGGACAAAACTTCCTCTTCCCTTTAAAACCAGCTCAAACTAG
CCCCCATGACTCACAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98864073..98864188 116
 
EST/CDNA Est Name
  CV305768.1


Sequence tag IST13052D7HMR1
Sequence
NGGAGCAAAAGAGAAGGCGACCTGAGCCNGCACCTTTCAGTCGGGTGACACCAAGGCAGATTTTCGTTAGAGGTTTGAGA
CGTTTGGCTTTTTAGTTCGGTTTGGTGTGGGAGTTTGTGCCTTTTGTGTTACTTTTTTCGAGCTAGGATTGGCGGGATCG
AATTGGGAACTTTGTTCATTGACTTTGATGGGGTGGAGGGAAGTNNTTNAGATCNCCTANGACCCCTCNCTCAGCCNGCT
CGGTTTCCCACAGATNCN
Sequence Type genomic DNA
Unitrap ID UNI33196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13115936..13116189 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042414 (Prdm14) NP_001074678 PR domain containing 14 Gene [Source:MGI (curated);Acc:Prdm14-001]

 
Come back to gene ENSMUSG00000042414


For any suggestions or comments, please send an email to unitrap@crg.es