Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10737G5
Clone ID IST10737G5
Vector VICTR76
Project tigm

Sequence tag IST10737G5HMF1
Sequence
NCTCTTAATTCCTGAGGGGGAGGGGGTCTGGCCCCCGGATGGAGGGGGCTGGCAACTGCAGGGATGCTGCCTTTGTTTGC
AGGCACTCCTTTGCCAAGGTACCTGGGGCCCTGANAAGATGAGTAGGGTCTGGGCTGGCANTTGTTCCTTGGCTTTTCCG
TTCCTTCCCAGCAGAGTCGTGGGAAACCTGCACGTGGGTGTGGCTGTGTGGCTTTAGCCAGCGGGGTGAAGCTCAAGCCG
GGTGAGGAGCGTGGCGAGAGCTTCCTTANCTGCCTTGGACCTGACCGGACAGCCTCTGGAACTGCACCGAGGCGGGGCGC
CAGGACGCANGTTGCTGGGCCAGCCACAGCACCTCCCGTCCCTTCCCAGAACGAGGCGGGCAGTANGGCCCGCAGCGTCC
CCTATGTATCANCTCTAGCTGGANACTANGCANGGGACNTATGCCTGGGGCTCCCTGAGCTGGGTGTGTGCAN

Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109395670..109396140 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]

 
Come back to gene ENSMUSG00000031910


For any suggestions or comments, please send an email to unitrap@crg.es