Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14197D4
Clone ID IST14197D4
Vector VICTR74
Project tigm

Sequence tag IST14197D4BBF1
Sequence
NAACTCCNNTGAGGAANAGGGCCNAGGATGCTGANACAACCNNANNGGGANNGANAGGCAAAATGCNATCCTGGACTGNA
NTTTCCTTGCCCATTATTCTAAANTTTCTCTGGGGTCCAAAAAATAAAAAAATGAANCCTACGGAATCCCAATGGCTTAT
NAATTCCAGGCAAAATATANACNCAGGGTAAACTTGCTCTCTATTTTCCCTTCNTTTAAAAAACNAAACAAAACAAANCC
CNCAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14197D4HMR1
Sequence
GTTGCATTGCACTTCAGAAAGAGATGGGTTTAGACAGAGATGGGAGCCTGTCAATCATATCTTGCTCTGTACAAAAAAAT
TAATAATGATGATAAAAGAGCC
Sequence Type genomic DNA
Unitrap ID UNI14923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44387173..44387273 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


Sequence tag IST14197D4HMF1
Sequence
CAACTCCAGTGAGGAANAGGGCCGAGGATGCTGAGACAACCAGANNGGGAAGGGAGAGGCAAAATGCGATCCTGGACTGT
AGTTTCCTTGCCCATTATTCTAAAGTTTCTCTGGGGTCCAAAAAATAAAAAAATGAAACCTACGGAATCCCAATGGCTTA
TGAATTCCAGGCAAAATATAGACACAGGGTAAACTTGCTCTCTATTTTCCCTTCATTTAAAAAACAAAACAGAACAAAAC
CCACAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44387270..44387524 249
 
EST/CDNA Est Name
  D77853.1

 
Come back to gene D77853.1


For any suggestions or comments, please send an email to unitrap@crg.es