Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12419A4
Clone ID IST12419A4
Vector VICTR76
Project tigm

Sequence tag IST12419A4HMF1
Sequence
TCTATATTCGATGACTTAGCTCATAGATGAGCTCATATAAGCTCGTAGCTTATAGGTTTCTTTTTTCTTCTTCTTCTTCT
TCTTCTTTTTTTANGGACATAGACCTGAAAGGAAATGACAGGTCATANCCAGGATGANCCTGTGANAANAANACGTGANT
CTTTTGTGTGTGTGGATGGCGTGTTGCTGGGGGCTGGAANCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12419A4BBF1
Sequence
TCTATATTCGATGACTTAGCTCATAGATGAGCTCATATAAGCTCGTAGCTTATAGGTTTCTTTTTTCTTCTTCTTCTTCT
TCTTCTTTTTTTATGGACATAGACCTGAAAGGAAATGACAGGTCATAGCCAGGATGAGCCTGTGAGAAGAAGACATGAGT
CTTTTGTGTGTGTGGATGGCGTGTTGCTGGGGGCTGGAAGCCAGAGAAGATGTGAATCTCATAAAGGTGGTAACCTCGGT
TGGGGGCTTGATAGGATGTCAGATCCAGTTTCCTCTGAAAGAGAACAGTATCCAAGGGCTCTTCCTTGGCAGGCTTGACA
GCAGGCTATCTCACGGCCTCTGTTCAAAGTGAGGCTCACCACAGACAGCTCATCCCGAGGAGACTCTGTAGTGTTCATCT
GTGANAAATCAGATCCTATCAGTAGCAAAGGCTGTGCTTCTTATTCTTAGTGCTCCTAANACAGTGGCAGGTTCAAGTAG
CTCTGTCTAGCNNGGGGGANTTTGTTTGGCCTTTATTTCTAATCTTATTCTACAGANGCNGAAATCTTGTCCTGCNCNCC
TGANNCTTN
Sequence Type genomic DNA
Unitrap ID UNI7651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108565415..108565982 546
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032602 (Slc25a20) NM_020520 solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 Gene [Source:MGI Symbol;Acc:MGI:1928738]

 
Come back to gene ENSMUSG00000032602


For any suggestions or comments, please send an email to unitrap@crg.es