Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12092H10
Clone ID IST12092H10
Vector VICTR76
Project tigm

Sequence tag IST12092H10HMF2
Sequence
CTTTGTTNAGGTGGGCTCCCAGCCAGAGCCTGGGCGCACAGAGCANACTGTGTGGGCCCCAGAATACTGAAACCTCGTGG
GGTAAGAGGAGGAACACAAGTAGCGAGAGGCCTTGGCTATGGGAAAATTGGAATAATTAACCATTAAGAATGAGTGTCTT
CAAAAGAGTGTAATTGGGGAGACTGAANAGTTGTANAGACGCACAAAGAAGTANAATGGGAACAGAGGGTTATTATCTGG
ANACCAGCGGTGGAGGAACAAGTGCATAAATACNNAANGGCCNNTTTCCTCCCTTGTGGANGGTNACAGTCNCAGTGACT
GANANTCNCTGANCTCCTCANACTTCCTGANCCTCNNTGCTGTTCTAAGCACTGTGTANCNNCCGCTNTGANGTAAGCNG
TATTGTTCNCGTCTGGNTNTACNGAGCANGANNCTGNGGTCNNTCANNATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12092H10BBF1
Sequence
TGAGAAACCAAAAGAATTACAGAAAGGGACTTTCAACATACGCTTAGGGGTTGGGCCTTGGCTCTGTCGCAGGTAGAGAT
GCCTGGAACCACAATTTGCACGCGCGTGTGTCTCGTCGGTCAATGGAATCCTTGACCCGGATGTACTACTGTACATCTCC
GCAAACCCCGCCCAGAAGCAGTGGTTAGTAACCGGAAAGTCTCACGTTTAGCGGGCGTCCCGGAAGCGGAAGCAAGTCCG
TTTCTTTTCTCCGTCCCTTACGTTCGTCCTGCGTTGTACCTGTTGTGCCAGGGCGGTTCGCTGAANCGGTTCGGAGCGTG
AAGAANAGTGGAACCCTGANTTCCCGGANCATCAGCAGCCNTGGCGGATGTGACTGCCCGCAGTTTGCAGTACGAGTACA
AGGCGGTGCGTGTGGTCTCNAANGACCGGTGCAGACAGGGGANGTCGTGGACAGCCACGGACACTTGAGCGGGANANNAG
ANCTGN
Sequence Type genomic DNA
Unitrap ID UNI34696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127033870..127034354 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003660 (Ascc3l1) NM_177214 activating signal cointegrator 1 complex subunit 3-like 1 Gene [Source:MGI (curated);Acc:Ascc3l1-001]

 
Come back to gene ENSMUSG00000003660


For any suggestions or comments, please send an email to unitrap@crg.es