Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13878E10
Clone ID IST13878E10
Vector VICTR74
Project tigm

Sequence tag IST13878E10HMR1
Sequence
NTTANNNNNNTGCTNNNNGGACAGTTGCTGGGAANCCTGTACAAGAGAGTGGCCTCTAAATCCTACTTCTTGATAAAGAG
AACTCGTGAAATTACTTTTTCCAAAAAAAGAAAAGTTGTAGTGGTACTGAGACGTTACAGACTATGANAAAAAGGAATAG
GGACAGGGAGGTTGTGTACATAAGAGTTTGAGTTGGAGAAGTAAAGTGAAATCCAAATAGTGAAAAGTTTAACCAACACT
AAATGAGATGAATTATCTTTTTGAAGCTCTTTGAGCAGGAAACTGATATGGTCAGATTTGTACTACAGAAAGTAATTTTG
TTCTCTGGGAAGCCTGTANAATAGAAATAGCTGACTCTGGGTTCTCTTANCTAAAGTCTAGGTACTTATATTTGANATTA
TTTTGAAAAGGTGATGACGTCCTGGTGAGATGCATTAANAATCTAAAGTANAGTTACGGTATTGTTACAAN
Sequence Type genomic DNA
Unitrap ID UNI18574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37297554..37298004 434
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]


Sequence tag IST13878E10HMF1
Sequence
AAAGTAACATATTGCATACCCTCCACCCTCTTACGAACATCAATTTGCTTATAAATGTCGCTTCCAAACTGGANATGAAC
ACTGGATATTTGATGAACCTCTATTGAATGGCATAACACCAGTAATTCAAAAGGTGCTGTAATCCGCGGTTGAGCAAGGG
TAAAACCCATCAAAACCTGGCACTTACAGTANACTCGCGGTTGGCACTGAAGGCCTTGCCTTGGCTAGCTCCCGCCGTTC
AGTTTTCTGCCGGCCTCAACTGCAGCACTTTTTACAAAATGCCANAGTCTGGCTTCCTGGCCAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37298020..37298324 299
 
EST/CDNA Est Name
  BC060655.1 - NM_199025.2

 
Come back to gene BC060655.1 - NM_199025.2


For any suggestions or comments, please send an email to unitrap@crg.es