Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1093
Clone ID PST1093
Vector U3NeoSV1
Project escells

Sequence tag PST1093
Sequence
TCAACTGTCACCACTTAGGATTCGTGTTTTCTCTTTGGGTTGTCTTGGAAGTCTTCCTGCAGTTTTTTGCTTTAACATAA
TCTCGTAGTTTACTACCACTAATACGCCTTTCTACTTTATTTCCAAGGTGCATAGTCTGCCTACTCTTTACTTTTCTCCA
GCAATTGTGTACAGTAACAATTGGAGCTTTTAGGGATTC
Sequence Type genomic DNA
Unitrap ID UNI4705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41221070..41221270 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es