Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14390E2
Clone ID IST14390E2
Vector VICTR74
Project tigm

Sequence tag IST14390E2HMF2
Sequence
TTGCCCTTCTGTTACAGGCTTCATTAGCAGTCAGGAGCTTGAGGCTCCAAGTACCCAAAGGACCAGAGATAGAAATGGAC
TGCATGGGGGCAGGGAGCGCTCAGGTTCCTTCCTGGGAGCTTGAAAGTGAACAACCCCAGGTAGGGCTGAGCACAGGGAG
GGGGAATGTAGGCTGGGTTGAGAGTAGCTTTATCATGTAGATCTCGGCTGGGGACCCTGGGATAGTAAGCAGCTTTTACA
AGCTTCCACTATATATCATTTGGAAATGGAATTATCTATATAGTAACTAAAGTTGGTGCAAAGATTAAAAATCAAAGTCA
CACATCAACAGCTAGTTTAGTATTCAATGGAGGCACGCCATGAACACTGTANCTATTGTTTGGTGAAAAATGTTTCCAGT
CTGGCTCTGACCCCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109142092..109142511 418
 
EST/CDNA Est Name
  BY354194.1


Sequence tag IST14390E2HMR1
Sequence
NCTCGGTGGAGGGCCGGTGGCTGAGCAGGGTTGGCGGCCCNCTGTGCTGCACCGCGGCGGCNCCCTCCCCCTCCTCCTCC
TNCATCACTACCANCGGGCCTTGGGCCTAGCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14390E2BBF1
Sequence
GGGGCGGTCACATGCTTCTGAGACAGCCTAAAGCAAGAGGGTAGCAAAGGAAGCCCTATTTTCTGGTCTTAATTTCTTTC
ATTCATTTTTGGAGCTAGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI11185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88813476..88813607 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es