Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14945A5
Clone ID IST14945A5
Vector VICTR76
Project tigm

Sequence tag IST14945A5HMR1
Sequence
NNNACCCGCCATTCCAAACTTTTGAAAAGTAGGGGAAGGCTGTAGCATGAGGTTCTGCGTATGTCTTGCAAGTTTAATGT
ATTAAATTAGTAGACTTCTTGGTGATCATGAAAAACCCAAATATGTTCACTCCGTGGGCTANAACAGTTTTCTTCCCCTG
AGATTTCTTTGGAGGGTCATCANGCANAAGTTTTCCCTCACTGCCTTGTACTTGATGACCCGAACCCTTGGTCTTCATCT
CCTGAAAGAATTTTTCAACACTANCCTCACTTTACCTGGTGACCTT
Sequence Type genomic DNA
Unitrap ID UNI29773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100115015..100115297 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]


Sequence tag IST14945A5BBF1
Sequence
CTAGCCTTAAAGAAGAGGGATTATTTTTCCTTTCTGGGTTACCAATACCCTAAACGGCTTCTCTAGCAACCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100114938..100115013 76
NO GENE  


Sequence tag IST14945A5HMF1
Sequence
CTAGCCTTAAAGAAGAGGGATTATTTTTCCTTTCTGGGTTACCAATACCCTAAACGGCTTCTCTAGCAACCGGATCCCAG
ACGCACTTATGCGCTTCCTGGAAGCCCATCACCCCCTTCCTTCAATAAACAGCGTGCTGGGAGGCCTAAATGGAGCTGCA
GCTCCAAGGCAGCAGCCACCAACCTGCGAGGCAAAGGCGAGACGCGTCTAGTCGCCGAGCCAGGAGCATCCCACACCGCA
CCATGGGAGCCGCCATCTTGGAGCGCACCAAGTGGAAGGCGGGCGTGGGGGGACAGGCNNANANCCNNCCTCCNCCNGAA
ATGGTCCTNCNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100114686..100115013 310
NO GENE  

 
Come back to gene ENSMUSG00000041632


For any suggestions or comments, please send an email to unitrap@crg.es