Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12128F10
Clone ID IST12128F10
Vector VICTR76
Project tigm

Sequence tag IST12128F10BBF1
Sequence
TTTGTTACTTAAATAAGTATTCNGGTCACTAATGANTGTTGTTAGTACACATGAGAAACAGGATTTGAGAANAGTTATTA
NGAAAATTTTANAAACTGACAAGTTGTTATTAAATTGCTAGGTTTTTAATGTTCAACTTTANAAACAATGAACTTGTATG
TGTAGGAAGAGATTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27187644..27187822 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]


Sequence tag IST12128F10HMF2
Sequence
AACCCTGAAATTTCCAGCCTAGGGAAATAATCCAGACAGTTCTTCTTTCTGCTTGTGTGCCCCTTTCTCTCTCTCTCTCT
CTCTCTNNCNCCCTCTCTCTCTCTCTCTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 93215139..93215248 104
NO GENE  

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es