Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14985G1
Clone ID IST14985G1
Vector VICTR76
Project tigm

Sequence tag IST14985G1HMF1
Sequence
GTGTGGCTAGCCGCCCTTCACCTGTGCCTCCTCCAACTGACGTACATGTAGACCTGTCCAGAGCTTCGCTGTATTTATCT
GCCCTGCTGCTGGGGAAGTCTTTGTAGCCACTCCTTTGGGCCAATGTTTCTGGAGGAGAAATTCCTAGAAGTGGGATCAC
TGGATCCAGAGCAGGTCACATTCTAAGTTAGGAGGGAGAGACTGCCAACCTGACTTCGGAGGAGGTGTGCCAGGTTGCAC
CCCATCAGCCGTGCCCAAGTGCCTGTGTCTCAGACTCCTCGCCAAGAGCAGTGACTATAATAATAAGCCTTGCAGTTTTG
CCAGTTGAGTTGGAAAATGGTGTCCTTGCTAATTTGCATTTCTTCNGTTCGATCGGGGACTATCTATTCATATGTTTATT
GGA
Sequence Type genomic DNA
Unitrap ID UNI28336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6411129..6411530 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]


Sequence tag IST14985G1BBF1
Sequence
GTGTGGCTAGCCGCCCTTCACCTGTGCCTCCTCCAACTGACGTACATGTAGACCTGTCCAGAGCTTCGCTGTATTTATCT
GCCCTGCTGCTGGGGAAGTCTTTGTAGCCACTCCTTTGGGCCAATGTTTCTGGAGGAGAAATTCCTAGAAGTGGGATCAC
TGGATCT
Sequence Type genomic DNA
Unitrap ID UNI28336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6411129..6411294 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]

 
Come back to gene ENSMUSG00000032946


For any suggestions or comments, please send an email to unitrap@crg.es