Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10994C3
Clone ID IST10994C3
Vector VICTR76
Project tigm

Sequence tag IST10994C3HMF1
Sequence
AAAAGAATATAATACTGAGTTATTTTTATCCTTTTGGCTTGTCTTGTTTGTTTGTGAGGTGTTGTCTTGTGTAGTCCAAA
CTAGCCATGAGCTCTTTGTGTAGCCCAAGATGACCTTGAACTTCTGACCCTCCTACCTCTGCCTCCCTGAGTCTAGGATT
ACAGTGGTCATGCACTACTACTAGTACTTCACATTTCTTGTCTCCTTTAATTCTCACAGGTATTCTAGGACTGCTAGTAC
ATTTACTCACTAAGACATTTTAATTTTATTTTGCCTGCATGTATGTCTGTGTACTCTTGAGCTGCCGTGTAGGTGCTGGG
AAGTGAANGAATCCNGGTGCCCTGGAANAACAGCAGATGCTGTAAACCACTAAGCCATCTCTCCAGTCCTTTCAACCTCC
ATTTGACATNANGAAAATAATATCTCCCGGANAGTAGCTTTCATTCTCAGANCCNACACAGANGTTAACG

Sequence Type genomic DNA
Unitrap ID UNI20164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74441064..74441532 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069814 (E130309D14Rik) NM_001013784 RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]

 
Come back to gene ENSMUSG00000069814


For any suggestions or comments, please send an email to unitrap@crg.es