Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14783D11
Clone ID IST14783D11
Vector VICTR76
Project tigm

Sequence tag IST14783D11HMF2
Sequence
AATTCAGGGACTCCCAAAACTACATGGGCCTGTAAATTTTCCCTAATCTGCTTTACCTCCATCCTGAACTTATTTAATTA
TCTGTACTACTCTCTTTCCAGAATAGACTACATCCCAGTTTCTCCAAGACAGAGCCAGTATAACTAATTTTCATTCTCTA
TAATAAAGACATTGATCAAACAGGACCAGAGGAGATGGACTTTAATCCCAGTACTTGTGAGGCAGAAGTGGAGCTCTTTG
AGTTCAAGGACTGTGGTTTACATAGCAAATTCTAAGCCAGTTAGAGCTACATAGCAAGAGCCTGTCTTAAAAAATGTATA
AATGAATAAAAATAAAAAGGAATGATCGAATATGACTTAGACTTAGTTTGTATACCTTTTTAAAGCTTTCTATAACCNAA
TTTCACACATGATTTTTTTAATGTTGTGCCCTAACTTTTTTANACTGCACGANCATATGGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82323642..82324103 456
NO GENE  


Sequence tag IST14783D11HMR1
Sequence
AATTGAATGAGCTACCTATGTTTTTAGCATTGAGAAAACCAAGACAACAGTGACTGACAATTTTAAGCCAAAGAAGATGC
ACAGTGTCATTCTTGCACTGGTGGTCATGGCCTCTGTGACTGTAAGTTCCTTGTCAAGTAAAATGAAAAAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82324100..82324254 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es