Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14668B11
Clone ID IST14668B11
Vector VICTR74
Project tigm

Sequence tag IST14668B11BBF1
Sequence
GGTGTCCTGCACAGAGTACTTATTTTTCATTCACAGACTACCCTANAACAACCACCTGAACTCCACTACACAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120492894..120492971 76
NO GENE  


Sequence tag IST14668B11HMR1
Sequence
ACCTGGGTCTTTCTTTGGGAAGGAATTTCCTGAGAATGACGTATGTCTCAAGAATGACATGGATTCTTAGAGGTTAATAA
TATGTCAAAGGCTTTCCAGTCTAATAAAAAATAAGTTAAAATTAATAACATCTTTTTTGAGCTTGTAC
Sequence Type genomic DNA
Unitrap ID UNI943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120492750..120492896 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es