Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14767H11
Clone ID IST14767H11
Vector VICTR76
Project tigm

Sequence tag IST14767H11HMF2
Sequence
CCGAGTGCTGAGATTAAAGGCGTGCACCACCACACCCGGCTA
Sequence Type genomic DNA
Unitrap ID UNI3618 UNI31127 UNI31519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23714826..23714866 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 48662549..48662589 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135200084..135200124 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3343466..3343506 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026648 (Dclre1c) NM_146114 DNA cross-link repair 1C, PSO2 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dclre1c-002]


Sequence tag IST14767H11HMR1
Sequence
AAAGCGAAATCTGTGCCNCCTGGCACACGGGCCGTGAAACCTGGTGGTCAGTGACAGAAACTGGGTCCCCAAGTAATACA
GATCTTGTGACTGAACGGATTCAAGACACACAGAACTGGCAGTTTCACAGAACTAGCACTCCTGGCTAGGCTGTATACTA
AGCCTCAAAGACAGAAAGCAGATCACTGGCAGGGGAAACTAATGGTTATAACATACCTGGGAGGGTGGGGGTGGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102957003..102957239 235
 
EST/CDNA Est Name
  BY068699.1 - BY231679.1 - BY324399.1 - BY236600.1

 
Come back to gene BY068699.1 - BY231679.1 - BY324399.1 - BY236600.1


For any suggestions or comments, please send an email to unitrap@crg.es