Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631A6
Clone ID IST14631A6
Vector VICTR74
Project tigm

Sequence tag IST14631A6HMR1
Sequence
ACACATGACAGGCACAGTACAGCAGGTACCTAGTGCTTGCCGTTAATCAAGACAGAAGTGTAAACAGGCTTTGAGATAGA
GGATACCCTGTGAGGCTTGCTTGGGTATCTGGTGGTCATGGAAGGAGACATTTAGGTTGGGATCTGGGGCATGANAAAGA
ACCGACTTTGTGGAAGGCTGGCCC
Sequence Type genomic DNA
Unitrap ID UNI26771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97527274..97527456 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]


Sequence tag IST14631A6HMF1
Sequence
TTATAAACTTAATAAAATGTGACCTATGAGCAACCCTCTGGCTGTGCTACCGAGGGAGCTCGGAGCGCAACGGTGGCACC
CAGGATTGCTACCAGGAAAGGGAGGAGTGAGGGCCGCTAACCTTGTTGAAGCGATCATGAGGCACGTACTGCAGAACGAT
GGGCTCCATCGTGAGCACGTTGGCGAACTGCACCTCCGGGATGTAGAGGGCGCACACCACATGGGCCCANCCTGGGGCAG
TGTGGGGACTGGCCTCAGCAGGACGGCAACACAAGACCCCACNCNTCCCAACACCAAGCTGTAGACTGTCCCNTGCGTCT
ACNNCCTTCCTGTACNAACAGGANCNNGGAAAGCCNGCCTCCACCCCACACCNGCNNGGGGGCCNNNCTGACCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14631A6BBF1
Sequence
TTATAAACTTAATAAAATGTGACCTATGAGCAACCCTCTGGCTGTGCTACCGAGGGAGCTCGGANCGCAACGGTGGCACC
CAGGATTGCTACCAGGAAAGGGAGGAGTGAGGGCCGCTAACCTTGTTGAAGCGATCATGANGCACGTACTGCANAACGAT
GGGCTCCATCGTGAGCACNTTGGCNAACTGCACCTCCGGGATGTANAGGGCGCACACCACATGGGCCCAGCCTGGGGCAG
TGTGGGGACTGNCCTCAGCAGGACGGCAACACAAGACCCCACGCCTCCCANCACNNAGCTGTANACTGTCCCCTGCGTCT
ANAACCTTCCTGTACCANCAGGANCAGGGAAAGCCANCCTCCACCCCACACCTGCTGGGGGGCCTGGCTGACCTNNNCAN
NCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97526881..97527274 364
NO GENE  

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es