Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12593C8
Clone ID IST12593C8
Vector VICTR76
Project tigm

Sequence tag IST12593C8HMF1
Sequence
CCAGGAATGTGTTTGCTTGGAAGAAACTGAGGCCAGGCTAGTGACTTCACACAAAGGCAGGCTGGCCCTGGTGCTCANTA
AAAGACCTGGAGACTAANACTCTCGACAGGCCCTTTTCTCACGTGTGTAAGGTGGATTGGAGGGTGGGTACTGGGCNCNC
CNCCN
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26059079..26059242 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es