Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0525
Clone ID XS0525
Vector pGT0lxf
Project sanger

Sequence tag XS0525
Sequence
CCTCCTCTATCTCTCGGCCCCCCTAACCGCTTCCCCGCGTTGCCTTCTTATCCTATTCCTACCTACTCCTCCCGTGTGAT
CCGCAGCTGGCGCGGAAGCTTCAGGTGGCAAGCGATCG
Sequence Type mRNA
Unitrap ID UNI2539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29123714..29123758 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003435 (Supt5h) NM_013676 suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]

 
Come back to gene ENSMUSG00000003435


For any suggestions or comments, please send an email to unitrap@crg.es