Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13069D5
Clone ID IST13069D5
Vector VICTR76
Project tigm

Sequence tag IST13069D5BBF2
Sequence
AGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31022 UNI31023 UNI31024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5733098..5733145 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37205767..37205814 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079714 (Pcdha6) NP_031793 protocadherin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:1298367]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10692527..10692574 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79862449..79862496 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31333508..31333555 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3302197..3302244 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 49338132..49338179 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20069100..20069147 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019992 (2610016C23Rik) NP_082206 RIKEN cDNA 2610016C23 gene Gene [Source:MGI Symbol;Acc:MGI:1919054]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 142423100..142423147 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4669501..4669548 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 120691168..120691215 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 13824724..13824771 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51374006..51374053 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98690257..98690304 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18043368..18043415 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 23995263..23995310 48
NO GENE  


Sequence tag IST13069D5HMF1
Sequence
AGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAATCAGATCTTGTTACACATGGTTGTGAGCCACCATGTGGTT
GCTGGGATTTGAACTTCAGACCTTCGGAGAGCAGTCAGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514418..98514571 148
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es