Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12739H9
Clone ID IST12739H9
Vector VICTR76
Project tigm

Sequence tag IST12739H9BBF1
Sequence
TGAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCN
Sequence Type genomic DNA
Unitrap ID UNI8348 UNI12847 UNI29663 UNI34719 UNI34720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 104293..104341 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 718..766 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 178119..178167 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030768 (Disp1) NP_081142 dispatched homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4038982..4039030 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35944869..35944917 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28130404..28130452 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024219 (Anks1) NM_181413 ankyrin repeat and SAM domain containing 1 Gene [Source:MGI (curated);Acc:Anks1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 10996134..10996182 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8647301..8647349 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51115881..51115929 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3363913..3363961 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4777544..4777592 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4228363..4228411 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8695129..8695177 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4582522..4582570 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 17687643..17687691 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37702277..37702325 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5605784..5605832 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24688956..24689004 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028938 (Galntl5) NM_026449 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 Gene [Source:MGI (curated);Acc:Galntl5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 9054735..9054783 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9555307..9555355 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7658338..7658386 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6184279..6184327 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 52828964..52829012 49
NO GENE  


Sequence tag IST12739H9HMF1
Sequence
TGAGTACACTGTAGCTGTCTTCANACACACCAGAAGAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATATGG
TTTCTGGGAATTGAACTCAGGACCTCTGGAANANCAGTCAGTGCTCTTAACCACTGTGCCATCTCTCCAGCCCAGGAGGT
AAGTCTTAACTGGCAAGGGAAGTGGCCCAGAATTTATGCTAAGGGATGGATGATGGTGGACAACGGGGCATTAAGGANAG
GGGCATCCGGGTAAGGCACCTGAGTGGAGCTGATGCTTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88253949..88254230 274
NO GENE  

 
Come back to gene ENSMUSG00000028938


For any suggestions or comments, please send an email to unitrap@crg.es