Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1156-1
Clone ID PST1156-1
Vector U3NeoSV1
Project escells

Sequence tag PST1156-1
Sequence
ACCANTGTGAGGGTGGGTGNCNGCATCTCCTTCCTTCTCCCTNAAGATTGCCCTGCCAACCCTCTGCAGGTCAGCCTCAG
CTGTCAGCAGGCTGTTGGGGAGACTCAGTTCCCTGAGTGACATCTGAGGAGCAACCNCAGAGAGAGGATGGCCCAGGTCC
TGCATGTGCCCGCCCCATTCNCAGGTCAGGGGCTGATCGGAGGGGAAGGGAGGGGGTTTGAATAAAAGAGGATGCTCAAA
CCAGTCGGGGTGGGGGTGGGGAGAAGGCAGCCACATATGAGGGCCAGAGGTGGGGGAGCAGCTTTGACTCTGTGGCCTGA
CACACAGCTCTAACTGTGCCGGTCTGAGGCAGGGGACTGCCCTAATGTGAGGGTNTAAGGTGGGAGGACAGCCCTAATGT
GAGGTCTGAC
Sequence Type genomic DNA
Unitrap ID UNI14927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21600300..21600699 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es