Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST483
Clone ID PST483
Vector U3NeoSV1
Project escells

Sequence tag PST483
Sequence
CTTAACTTGGTTTTTCTCTTGGGGTGGAGATTGAGGCTCATGCAT
Sequence Type genomic DNA
Unitrap ID UNI86

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128062950..128062993 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]

 
Come back to gene ENSMUSG00000025362


For any suggestions or comments, please send an email to unitrap@crg.es