Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13417D1
Clone ID IST13417D1
Vector VICTR74
Project tigm

Sequence tag IST13417D1BBF1
Sequence
AGTTCAATTCCCAGCAACCACATGGTGGCTCACAAT
Sequence Type genomic DNA
Unitrap ID UNI6743 UNI32989 UNI34726 UNI34727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 70207..70242 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7284260..7284295 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6110804..6110839 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3100673..3100708 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13824090..13824125 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54770933..54770968 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24108606..24108641 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021338 (Lrrc16a) NM_026825 leucine rich repeat containing 16A Gene [Source:MGI (curated);Acc:Lrrc16a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3282389..3282424 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020671 (Rab10) NM_016676 RAB10, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105066]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3313544..3313579 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21133096..21133131 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 11404263..11404298 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27772950..27772985 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26732891..26732926 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5828312..5828347 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029757 (Dync1i1) NM_010063 dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI (curated);Acc:Dync1i1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3035674..3035709 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5087922..5087957 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028926 (Pftk1) NM_011074 PFTAIRE protein kinase 1 Gene [Source:MGI (curated);Acc:Pftk1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 31997881..31997916 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9648797..9648832 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 10024334..10024369 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10745969..10746004 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 8348787..8348822 36
NO GENE  

 
Come back to gene ENSMUSG00000028926


For any suggestions or comments, please send an email to unitrap@crg.es