Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14505E1
Clone ID IST14505E1
Vector VICTR74
Project tigm

Sequence tag IST14505E1BBF1
Sequence
TACCNACAACAAGGCCATGTGTGTGGTCTACACCTTTGATTCCAGCACTCACGAGTAAAGCAGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80571844..80571914 69
NO GENE  


Sequence tag IST14505E1HMR1
Sequence
GCTTGTCTTGAAACTTTCTCCTCTCCAACAAGTATTGGCTAGGTCATTTCTGAGGTCTCTGGACAGAGAATCACAATTCT
ACCGTGACTGCAGAGCTCATTGGGAGGCCCTCCCTGTGTGTACCATTCAGGTTGTAAGAAAGCAGGAACAAAAGTAGGTC
TCCCTGACATGCTAGCCACAGGCAGTCTGCAGGATTCTGGAGCCCCTGGGATGCTGCATTTTGCCAANAAGAAGGCAAAA
GCTATAAGAGGGAGGGTCACGTGATGGGTCANAGCAGTGCTCAGAAATCCCAGGAAAGAATGGGANACAAAGAAAAGGAA
AAAACTGACCCCGGAAAAGTAAAAAAACAAGGCANAGGCGGGGTTGANAAAGAGGTGAGCANAANCTANAGGCCCAAGGC
ACTTGGAACCNGAGAGGCACAAATTCCAGTGGTGCGGGCANGACAGTGTCCTCANGTGACACTGCNTTTCANGCNNGNNA
TTGTNCTCNNNANACN
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43569861..43570348 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es