Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST821-2
Clone ID PST821-2
Vector U3NeoSV1
Project escells

Sequence tag PST821-2
Sequence
GTCTGCCAAAGCAGCAAGTGAGCCATCTCTCCAGGCTCTTTTTTCTCCCCNTAACTTTCTGAGATGGAGTTTCTTTGTGT
GTAGCCNTCAGACGCTTGTTCCTCCTGAATGTCTGCCACCATAACTGGCTCACTTCTCCCCGTAAACTTTACGAGGTCTA
GTATGTATTTTTGTTACAGGCNTCTTGAGCCTGTTTCTAGTTAGGGTATGGCTCAGCCCATAGCACATACCTTTCGTCCC
TCTGGCTAGAATATAGACATGCCCTAACCCTAACCNANAAANNTGATTCCAAACAATGAAGGAAGCACCATGCTTGGAAG
TCTAACTGCGTGNNAGACAAAGTGATGAATCTAGAAAGAGTTGACAGAATAGGATCTGTCAATAGGAAAGGGAGAGACTA
GACATTGGGNAGGAGAAGCATCCATACTGGATACACTAGAGT
Sequence Type genomic DNA
Unitrap ID UNI9742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164731264..164731701 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039834 (Zfp335) NM_199027 zinc finger protein 335 Gene [Source:MGI (curated);Acc:Zfp335-001]

 
Come back to gene ENSMUSG00000039834


For any suggestions or comments, please send an email to unitrap@crg.es