Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13411C11
Clone ID IST13411C11
Vector VICTR74
Project tigm

Sequence tag IST13411C11BBF1
Sequence
CTGGCCAGGGCTGAACCTCAAATGGCTGTATTAACAAAGAGTAAAGAGGTATGAAAGGTGTTAGTACATCAGGGGCTGGA
ACACACGTGTCATTCAAAAAGTGAAACTACAT
Sequence Type genomic DNA
Unitrap ID UNI34729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26252160..26252271 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074272 (Ceacam1) NM_001039186 carcinoembryonic antigen-related cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1347245]

 
Come back to gene ENSMUSG00000074272


For any suggestions or comments, please send an email to unitrap@crg.es