Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14319D5
Clone ID IST14319D5
Vector VICTR74
Project tigm

Sequence tag IST14319D5HMF1
Sequence
GTGACTTGTGTAAAATGGATTTGTAACCTACAAGTCACCAAACGATGACTANAANCTGCAGTGCTGTACAGGAATGTGAA
GGGAGGCCTCTGANCAGTCCAGGGTGTGCTTGACAAAGTCCCAAGTGCTCAGGACTTTTAGCCCTGTCTACTTTGGCTTG
GTTTGGATGATTCTTAAGTTTATTAGCCTAGTGATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95465165..95465364 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es