Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1222-NL
Clone ID PST1222-NL
Vector U3NeoSV1
Project escells

Sequence tag PST1222-NL
Sequence
GCATGCAGCCATAACTGTCCTGGTAAACTTTTTTGAATCATAGGAGAACTAGGAGAAAAAGAAATGTAAAGAAAT
Sequence Type genomic DNA
Unitrap ID UNI14923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44388151..44388224 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es