Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0504
Clone ID XS0504
Vector pGT0lxf
Project sanger

Sequence tag XS0504
Sequence
CCTCCACTTCACTTCTTGCTGTTCATACGTGTACCTTCTATCTGGACTTATAATCCTATCCCCTTCGTGGTTTCTTCGCT
TCGACGTCCTATTGCAGTGACCGGTCCTGTGTAGGCTCGTCGGCAACATGTCAGGGTACACGCCGGATGAGAAGCTGCGG
CTGCAGCAGCTGCGGGAGCTAAGGAGACGATGGCTGAAGGACCAGGAGCTGAGTCCCCGGGAGCCCGTGTTGCCCCCGCG
CAGGATGTGGCCCCTGGAGCGATTCTGGGATAACTTTTTGCGGGACGGGGCCGTGTGGAAGAACATG
Sequence Type mRNA
Unitrap ID UNI2542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40226191..40226403 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071014 (Ndufb6) NM_001033305 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 Gene [Source:MGI (curated);Acc:Ndufb6-001]

 
Come back to gene ENSMUSG00000071014


For any suggestions or comments, please send an email to unitrap@crg.es