Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14292H8
Clone ID IST14292H8
Vector VICTR74
Project tigm

Sequence tag IST14292H8HMR1
Sequence
TTTACATATTATGTGAGCGCTCCCCCCCATGGGGTAGGTTCTGAAACAGCACTCTGTGGTCAAACAAATATTTTTATAGC
AAGAAGTATGACAATATACACAAAGCAAAGTAAATGAGGTAATAGTACCACATAGGCTGGCTGCCGCTGCCTAATGACTT
ACAGAAAACTCACACTGTTTTGTTTTGCTTTTGTTTTTGCTTGAAAAATATTGCCTCTTAAAATTTACAAATAAAGCACT
GCAGGTCTGTACCATGAACGTTGTATGGGTTCANCTTTGGGATATAATTAN
Sequence Type genomic DNA
Unitrap ID UNI31336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103474833..103475122 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042757 (Tmem108) NM_178638 transmembrane protein 108 Gene [Source:MGI Symbol;Acc:MGI:1932411]


Sequence tag IST14292H8HMF1
Sequence
TTAATACTGCATTTGCTTTTCAAATATGAAAAGTTCTGAATTACACATCTGACCTTGTGAGTTTCAAATAAGAGAGCATG
GAAGAAAAAAAACCAACAGCCAGAAATCAAATTATGGTTCTCCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103475121..103475248 128
NO GENE  

 
Come back to gene ENSMUSG00000042757


For any suggestions or comments, please send an email to unitrap@crg.es