Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14959A1
Clone ID IST14959A1
Vector VICTR76
Project tigm

Sequence tag IST14959A1HMF2
Sequence
AGACTAGCTAATCCTCCACACAGCCCCAATCCCCATGCTGTACCTAATAAGCACTCTGAGGTTCCTTGTTGAGGCTGTAG
CAGTAACAGAACCCCACCTGAGCCCAGCTTCCCTGGGTCTGGCTTTTCTTCAGCCCCTCACCTCCCTTAGCAGGGTTCCA
GGGCCAAAGTCTAGCAGGATGTGGCATACATACATGCAGACAAAAACTTANACACATGAAAATAAAATAAATCTTTAAAA
AAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84857996..84858242 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14959A1BBF1
Sequence
ATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTT
CAAAGTAAACGCTTCGGGCCCCGCGGGACACTCAGCTAAGAGCATCGAGGGGGCGCCGAGAGGCAAGGGGCGGGGACGGG
CGGTGACTCNCCTCGNGGCGGACCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 39984007..39984191 181
 
EST/CDNA Est Name
  BG796972.1 - AA407434.1 - DV070776.1 - CV304202.1 - BM231084.1 - BM199275.1 - BM199098.1 - CV308958.1 - CV306868.1 - CV307112.1 - CV306886.1 - BM507679.1 - BM730660.1 - BQ085576.1 - CV303617.1 - BM565413.1 - CK428421.1 - BI899485.1 - BM506157.1 - CF916651

 
Come back to gene BG796972.1 - AA407434.1 - DV070776.1 - CV304202.1 - BM231084.1 - BM199275.1 - BM199098.1 - CV308958.1 - CV306868.1 - CV307112.1 - CV306886.1 - BM507679.1 - BM730660.1 - BQ085576.1 - CV303617.1 - BM565413.1 - CK428421.1 - BI899485.1 - BM506157.1 - CF916651


For any suggestions or comments, please send an email to unitrap@crg.es