Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11834C7
Clone ID IST11834C7
Vector VICTR76
Project tigm

Sequence tag IST11834C7HMF1
Sequence
CATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTTTGAAATTGAGCGAGATCTCAGGCTGAGCAAAATGA
AACCTTGACATTCTGGGAAGGATTCCTAGCAGCTGAATCCTATTGACAATGTGAGCTCCTCTGAGTGTCTGTGAAATACT
TCCAGTGTTCCTCATCATGTTTCCAGCAAGTCCCTTTTTCTACGTTGCAGTTTGTTTAATGTATGTTAATTTCACCTGGC
TTCATTCATTTTCCTTTTTAAAATTTGTCTTTTAAATAAACAAACAGAACCCTCTGTGAGGTTGGTGAGAGTAAGGGTGC
CGTGCTCCTTCCCTGTGCTCTGCCTCTAAGGCTGAAGGCNAGCAGGCCCAGCCACCACATCTCAGACCTGTCTGTGATGG
TCACAAGCCTCTTTAAAGTCAGCCTTTCCTGGANACTCCTCNGNGGCTTCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292232..114292684 445
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST11834C7BBF1
Sequence
CATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTTTGAAATTGAGCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292684 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es