Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST18
Clone ID PST18
Vector U3NeoSV1
Project escells

Sequence tag PST18
Sequence
AAAATTGTTTTGCATAAGACAGCGGGTGCACGGTAGAACAAGACCTAAGTTTTCCTCTAGGTGTACATGTTTTATGGGCG
TGGGGGGCGGCTAGGCCTTGTGCATGCACNGCTAGGCCAGCCTTCTGCCGTTCAGCAATTCCCCGAGCCCACAGTTCTTG
GTTTGAGAATGAGGAAGTCAGTTAATTTGACCCCAAAGGACTAAGAATACACTGTAAGCTGGTTGTAAAGATCGGTGAGC
CTGTTAAAGCTTCAAGGAGCATGTTATAATCCTCTACGTTTTATTTACGCCTTTTTCATCGTTTTCACGCTCTACCCTAG
CCTTTTCATTTAGTTAATTTTATTGTTTGGAAAGATAGGTGGAAGTCACAGATCAGTTACTACAAATTCTACCTTTCTTT
CCCTTTAGCTT
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13183931..13184340 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es