Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1765-2
Clone ID PST1765-2
Vector U3NeoSV1
Project escells

Sequence tag PST1765-2
Sequence
GTGGTATGATCCGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCC
CAGCAACCACATGGGGCTCACAACCATCCGTAATGAGATCTGACTCCCTCTTCTGGAGGGTNTGAAGACAGTTACAGTGT
ACTTACATGTAATAAATAAATAAATAAATCTTAAAAAAAAAAAAAGAAAATGTAAAAAAAAAAAAAAAAAAAGAATGGTA
TGATCCCAGCATTCCAGAAGCAGAGGGCAGGAGCTTTCTGTGAGTTTGAGGTCAGCCTGGTCTAGAGTGAGTCCCAGGAC
AGCCAGGGCTACACAAAGAAACCCTGTCTTGAAAAAACACAAACAAACAAACAAGAATTTGATAGACAGATT
Sequence Type genomic DNA
Unitrap ID UNI14839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31884741..31885131 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es