Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13968F4
Clone ID IST13968F4
Vector VICTR74
Project tigm

Sequence tag IST13968F4BBF1
Sequence
CATGTGGTTGCTGGGATTTGAACTCAGGACCCT
Sequence Type genomic DNA
Unitrap ID UNI488 UNI4882 UNI34110 UNI34739 UNI34740 UNI34741 UNI34742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 159053..159085 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079135 (Sult1c1) NP_061221 sulfotransferase family, cytosolic, 1C, member 1 Gene [Source:MGI Symbol;Acc:MGI:102928]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5028678..5028710 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024891 (Slc29a2) NP_031880 solute carrier family 29 (nucleoside transporters), member 2 Gene [Source:MGI Symbol;Acc:MGI:1345278]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54121518..54121550 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023943 (AC154553.3) NM_018751 Sulfotransferase 1C1 (EC 2.8.2.-)(Phenol sulfotransferase) [Source:UniProtKB/Swiss-Prot;Acc:Q80VR3]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 78062717..78062749 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 46350270..46350302 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 34926745..34926777 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3903463..3903495 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020661 (Dnmt3a) NM_153743 DNA methyltransferase 3A Gene [Source:MGI Symbol;Acc:MGI:1261827]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19890200..19890232 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20864558..20864590 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 61189852..61189884 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60857882..60857914 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 128508527..128508559 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35051201..35051233 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038784 (Cnot4) NM_016877 CCR4-NOT transcription complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859026]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20467187..20467219 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41169542..41169574 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 50034789..50034821 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19965820..19965852 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 36005633..36005665 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14579128..14579160 33
NO GENE  


Sequence tag IST13968F4HMF1
Sequence
CATGTGGTTGCTGGGATTTGAACTCAGGACCCT
Sequence Type genomic DNA
Unitrap ID UNI488 UNI4882 UNI34110 UNI34739 UNI34740 UNI34741 UNI34742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14579128..14579160 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60857882..60857914 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19890200..19890232 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3903463..3903495 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020661 (Dnmt3a) NM_153743 DNA methyltransferase 3A Gene [Source:MGI Symbol;Acc:MGI:1261827]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 34926745..34926777 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 61189852..61189884 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 46350270..46350302 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 78062717..78062749 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54121518..54121550 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023943 (AC154553.3) NM_018751 Sulfotransferase 1C1 (EC 2.8.2.-)(Phenol sulfotransferase) [Source:UniProtKB/Swiss-Prot;Acc:Q80VR3]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5028678..5028710 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024891 (Slc29a2) NP_031880 solute carrier family 29 (nucleoside transporters), member 2 Gene [Source:MGI Symbol;Acc:MGI:1345278]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 36005633..36005665 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 50034789..50034821 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41169542..41169574 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20467187..20467219 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35051201..35051233 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038784 (Cnot4) NM_016877 CCR4-NOT transcription complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859026]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 128508527..128508559 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20864558..20864590 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 159053..159085 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079135 (Sult1c1) NP_061221 sulfotransferase family, cytosolic, 1C, member 1 Gene [Source:MGI Symbol;Acc:MGI:102928]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19965820..19965852 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]

 
Come back to gene ENSMUSG00000060090


For any suggestions or comments, please send an email to unitrap@crg.es