Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0491
Clone ID XS0491
Vector pGT0lxf
Project sanger

Sequence tag XS0491
Sequence
CCCCTGCCGCCGCCGACTTGCGCGGAGGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATG
GCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCATCCA
CGATGGCCTAGCACGTGGCATACGCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTCTCAGTCTCAATACTGTGGGGTGT
TGCAGCCGGAACAAAGACTGCAGCAGCCAAGGGAAGAGAGCGTGAAGTTCATGCTGTTAGCACAAAAGTTCTGAATGTCA
TCCGGCCAGCAGGAAACCTAGGAAAAGGCGCCAAGCCCATCTGTGTGTGCTCGCATCCAACTGTGATGAGCCCATGTATG
TCAAGACTGGTGGAGGCACTTTGTGCTGAGCACCAAATCAACCTGATAAAG
Sequence Type genomic DNA
Unitrap ID UNI2544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23505708..23506687 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061983 (AC160147.6) NM_011295 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]

 
Come back to gene ENSMUSG00000061983


For any suggestions or comments, please send an email to unitrap@crg.es