Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1155
Clone ID PST1155
Vector U3NeoSV1
Project escells

Sequence tag PST1155
Sequence
GGTTTCATGAAATGGCTGGGATTTGTCTTTTTTCTCGTTATGAGGAAAGGGAGGAGGGAAGGGTTTGAAAACCAGCAATT
TAGAGTTTTGACTCTTCCAAATTGGTGAAGATCTTGGCAACTAAAATGCTGGCTTTCAGACTGCATCGATCACCAGCTAC
CTTGGTCCATTGGCCATCACGTTTTCAAACATATTAAGGAGCACAGAAGATGCACATTGAAGAAAGTGGGAGTTCAGGTT
GGAATCTCCTTGAAATTCTGTTTCAAATTTTGTTCCAAGTGTTCAGTGTGCTTTTTTATCTTATCTCAGTTCCCTAGATC
TATTTTATATGAAAATGTTTAAATTAGCGAGGTAACAGGGCACCTACCTTTTCTCTCCACTTACCTCTAA
Sequence Type genomic DNA
Unitrap ID UNI11663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44391802..44392185 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es