Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12819F9
Clone ID IST12819F9
Vector VICTR76
Project tigm

Sequence tag IST12819F9HMR1
Sequence
TTGGTTTCTCTGTGTAACCTTGGCTGTCCTGGAACTCACTGTGTAGACN
Sequence Type genomic DNA
Unitrap ID UNI2859 UNI3533 UNI20340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47864485..47864530 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38393922..38393967 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64430677..64430722 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000127 (Fert2) NM_008000 fer (fms/fps related) protein kinase, testis specific 2 Gene [Source:MGI Symbol;Acc:MGI:105917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4582319..4582364 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81601346..81601391 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41061489..41061534 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78079003..78079048 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98879913..98879958 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570983..40571028 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105578853..105578898 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34762125..34762170 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 52012915..52012960 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30944011..30944056 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92896785..92896830 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029426 (Scarb2) NM_007644 scavenger receptor class B, member 2 Gene [Source:MGI Symbol;Acc:MGI:1196458]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54970909..54970954 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 38962486..38962531 44
NO GENE  


Sequence tag IST12819F9HMF1
Sequence
ATACATAGTTTCTTAGTGTAAGCAGCCCTGGCTGTCTTGAAGATACTTTGTAGGCCTCAATCCTGTAAGAGCCTTCCTCT
GCTTTTCAAATGCTGGAATGAATGTTGTACCTCACTATGACCGGCTGAGATTCTCACCTTTTCTTTTCTCCCCTCCCCCT
TTCTTTTTATGATTCTAGCTTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74916687..74916871 171
NO GENE  

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es