Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0445
Clone ID XS0445
Vector pGT0lxf
Project sanger

Sequence tag XS0445
Sequence
CCTTATTTGGTTTTTCAAGACAGGGTTTCTCTGTGTAGCCCTGGCTATCCTGGAACTCTGTAGCCCAGGCTGGCCCTGAC
TTCGCGCCCACACTCGTCTCCCCCTTCCCTGCTCAATCCCCGAAGGTGCAGCTGCCCGCCTACCTCAAGCAGCTCCCGGT
CCCCGACAGCATCACCGGGTTCGCCCGCCTCACAGTTTCAGACTGGCTCCGCCTACTGCCCTTCCTCGGGGTACTTGCGC
TTCTGGGCTACCTCGCAGTGCGCCCATTCTTCCCAAAGAAGAAGCAACAGAAGGATAGCTTGATCAATCTTAAGATACAA
AAGGAAAATCCCAAGGTGGTGAATGAGATAAACATTGAAGATCTGTGTCTCACCAAAGCAGCTTATTGTAGGTGCTGGCG
GTCCAAGACG
Sequence Type mRNA
Unitrap ID UNI2547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135073975..135086296 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028165 (Cisd2) NM_025902 CDGSH iron sulfur domain 2 Gene [Source:MGI (curated);Acc:Cisd2-001]

 
Come back to gene ENSMUSG00000028165


For any suggestions or comments, please send an email to unitrap@crg.es