Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12396F6
Clone ID IST12396F6
Vector VICTR76
Project tigm

Sequence tag IST12396F6BBF1
Sequence
AGGCTAGGTAGCCAGCTAATGACCTTGCAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI20020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4707843..4707878 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es